| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.242962 |
| Chromosome: | chromosome 2 |
| Location: | 207282 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g074600 | DeSI-2,CGL60,DESI2 | (1 of 6) PF05903 - PPPDE putative peptidase domain (Peptidase_C97); DeSI-type SUMO protease | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGAGCAAAGTCCTTCGCAGCGCCTGGGT |
| Internal bar code: | GGCACGGAGGGGCGGTGGATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 635 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGCAGTAACCAAAGCTCC |
| Suggested primer 2: | COULD_NOT_FIND_PRIMER |