| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.242991 |
| Chromosome: | chromosome 9 |
| Location: | 1884927 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395500 | HEATR2,HTR2A,HEATR2A,DNAAF5 | 5-Hydroxytryptamine Receptor 2A; (1 of 3) IPR016024//IPR021133 - Armadillo-type fold // HEAT, type 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACCGCTAGGGTTGAGGAGGGCTGTCGGA |
| Internal bar code: | AATGGTGTGCTTTCTGGTGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 232 |
| LEAP-Seq percent confirming: | 94.8454 |
| LEAP-Seq n confirming: | 184 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGAGACACATTCAGCCAA |
| Suggested primer 2: | ACCCTGCAAGACAAGCTGTT |