Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.243057 |
Chromosome: | chromosome 14 |
Location: | 2746918 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g627050 | (1 of 17) IPR001305 - Heat shock protein DnaJ, cysteine-rich domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAACCCCCGCACCCCCACGCACCGCACA |
Internal bar code: | GCAAGGTGGTTAGGAGCGTACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 436 |
LEAP-Seq percent confirming: | 99.5772 |
LEAP-Seq n confirming: | 1413 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAATTGACTTTGCCTGCTGA |
Suggested primer 2: | ACACACACTCCCTCTCACCC |