| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.243087 |
| Chromosome: | chromosome 1 |
| Location: | 6661269 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g047800 | GRX6 | Glutaredoxin 6, CGFS type, chloroplastic; (1 of 1) PTHR10293:SF45 - MONOTHIOL GLUTAREDOXIN-S16, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCTTCAGCTTCCGCATGATCAACATGCT |
| Internal bar code: | TTGGTGGAACGCCCCCAGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 199 |
| LEAP-Seq percent confirming: | 96.1864 |
| LEAP-Seq n confirming: | 227 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACATTAGCGCCCTGTACC |
| Suggested primer 2: | GGAGCCGTAAAGCTGTGAAG |