Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.243333 |
Chromosome: | chromosome 2 |
Location: | 1229042 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g082350 | CUTA1,CUT1 | (1 of 1) K03926 - periplasmic divalent cation tolerance protein (cutA); Copper-binding protein CutA | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATAGCCACATTCATGCCATCTGTTGCTC |
Internal bar code: | TGTTAGCACTGGGCCCGCGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 366 |
LEAP-Seq percent confirming: | 99.6 |
LEAP-Seq n confirming: | 249 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCCCAGAAACCAACACAT |
Suggested primer 2: | AAGGAATAACAAACGCACGC |