| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.243334 |
| Chromosome: | chromosome 3 |
| Location: | 2256425 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g157800 | TRXL1,TRL6,TRX2 | (1 of 1) PTHR10438:SF227 - THIOREDOXIN-LIKE 2-1, CHLOROPLASTIC-RELATED; Thioredoxin-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTATGATGTGGCGCTACCGTCCAGGTAC |
| Internal bar code: | GTCGAAGGCGTGGAACCGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 520 |
| LEAP-Seq percent confirming: | 92.8913 |
| LEAP-Seq n confirming: | 1555 |
| LEAP-Seq n nonconfirming: | 119 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTTATGGAATAGGGGCA |
| Suggested primer 2: | TGAATCCCTACCTCGAATGC |