Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.243564 |
Chromosome: | chromosome 9 |
Location: | 4681095 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396846 | (1 of 2) PTHR22957//PTHR22957:SF148 - TBC1 DOMAIN FAMILY MEMBER GTPASE-ACTIVATING PROTEIN // RE26521P | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGGGTTAGCCGACGTCCATCCCTTCACG |
Internal bar code: | CGCTCGACATGCGGCGCGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 247 |
LEAP-Seq percent confirming: | 95.6835 |
LEAP-Seq n confirming: | 133 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAACTTACCGCGATGCAAAC |
Suggested primer 2: | ACCACTCAAGGCATACGTCC |