Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.243682 |
Chromosome: | chromosome 1 |
Location: | 3601140 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g023250 | (1 of 33) IPR013830 - SGNH hydrolase-type esterase domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGAGAGACTGGGAGGCGGCGGCAATGGA |
Internal bar code: | AGGTTTAATTATCGCACAGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 473 |
LEAP-Seq percent confirming: | 99.4123 |
LEAP-Seq n confirming: | 5751 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTGTTTACAAAGCCACCC |
Suggested primer 2: | ATCTGGCAGAATAACCGTGG |