| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.243739 |
| Chromosome: | chromosome 7 |
| Location: | 5913947 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354100 | HAT4 | (1 of 1) K07739 - elongator complex protein 3 [EC:2.3.1.48] (ELP3, KAT9); Histone acetyltransferase 4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCCTCCAGGTGGTACCCCAGCTTGCGG |
| Internal bar code: | CGCATGTACTTGGAAAAATTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 232 |
| LEAP-Seq percent confirming: | 99.7522 |
| LEAP-Seq n confirming: | 805 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGGGATGAGGAGAGGGAG |
| Suggested primer 2: | GCTATGGCCAAGCAACTCTC |