| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.243767 |
| Chromosome: | chromosome 7 |
| Location: | 3929326 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g339200 | SCO2 | (1 of 1) PTHR36035//PTHR36035:SF1 - FAMILY NOT NAMED // PROTEIN DISULFIDE-ISOMERASE SCO2; Cytochrome c oxidase assembly factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGAGGCTCGCCAGTTTTCGATGGCCTCG |
| Internal bar code: | GACTCACTTATATGCTGCTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 885 |
| LEAP-Seq percent confirming: | 99.33 |
| LEAP-Seq n confirming: | 593 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCTCCACCATACAGAAGA |
| Suggested primer 2: | CGGCGTTTATTAAGCTCTGC |