Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.243853 |
Chromosome: | chromosome 10 |
Location: | 4685505 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g453400 | MSC4,MSCL1 | (1 of 1) PF00924//PF13202 - Mechanosensitive ion channel (MS_channel) // EF hand (EF-hand_5); Predicted protein with mechanosensitive ion channel domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCAACCCCCAACCCCAACCCCAACCACA |
Internal bar code: | GTCTGGCGGTGCATTTTGTGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 26 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTACTCCTTCTCCAGCGACG |
Suggested primer 2: | GGCGCTGGCTCTACTACATC |