| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.243853 |
| Chromosome: | chromosome 10 |
| Location: | 4685511 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g453400 | MSC4,MSCL1 | (1 of 1) PF00924//PF13202 - Mechanosensitive ion channel (MS_channel) // EF hand (EF-hand_5); Predicted protein with mechanosensitive ion channel domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTTGTGGAGATGGGGGTTGGGATTGGT |
| Internal bar code: | CCAAAGGGGGCAGCGCGGCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 612 |
| LEAP-Seq percent confirming: | 96.9124 |
| LEAP-Seq n confirming: | 973 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACTCCTTCTCCAGCGACG |
| Suggested primer 2: | GGCGCTGGCTCTACTACATC |