| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.243869 |
| Chromosome: | chromosome 12 |
| Location: | 1689046 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g485750 | CGL128 | (1 of 1) PTHR13420//PTHR13420:SF5 - UNCHARACTERIZED // UPF0235 PROTEIN; Conserved in the Green Lineage | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCTCCACCCAGCACTATACAGCCGCCG |
| Internal bar code: | TGGCCCGGGAGTGCTGATCTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 698 |
| LEAP-Seq percent confirming: | 98.9873 |
| LEAP-Seq n confirming: | 391 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCCCTCAAAAATACCCA |
| Suggested primer 2: | TGTTCGACCTCATCAGCAAG |