Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.243975 |
Chromosome: | chromosome 6 |
Location: | 3926252 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278186 | (1 of 1) IPR000157//IPR011251//IPR016024 - Toll/interleukin-1 receptor homology (TIR) domain // Luciferase-like domain // Armadillo-type fold | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATGGCCCCGCTATGCAATCGGGTGGTC |
Internal bar code: | AATCATTTTCTTGTACCTCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 824 |
LEAP-Seq percent confirming: | 99.6798 |
LEAP-Seq n confirming: | 5915 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCGCCTGTATGCGATAAAC |
Suggested primer 2: | GACAGTCTGATTGACGCGAA |