| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.243979 |
| Chromosome: | chromosome 9 |
| Location: | 3870757 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391986 | (1 of 1) 3.1.1.32 - Phospholipase A(1) / Phospholipase A1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAATCCTCATGTGTTTTGGTGCTGTGGAG |
| Internal bar code: | GCGAGCAGGTAGGCATGGCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 527 |
| LEAP-Seq percent confirming: | 93.4457 |
| LEAP-Seq n confirming: | 499 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTAACGGTGCTGATTGGG |
| Suggested primer 2: | AGCCAGCAAGAGTAGACCCA |