Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.244151 |
Chromosome: | chromosome 6 |
Location: | 4812095 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278200 | ROC66 | (1 of 1) PTHR31319//PTHR31319:SF4 - FAMILY NOT NAMED // ZINC FINGER PROTEIN CONSTANS-LIKE 3-RELATED; Rhythm Of Chloroplast 66 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCCGCTCTTGTGCTGGCACTGGGTACC |
Internal bar code: | CTCTGGATTTTTATCGATTGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 549 |
LEAP-Seq percent confirming: | 98.9715 |
LEAP-Seq n confirming: | 1251 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGAGACGGCGGACAGACTA |
Suggested primer 2: | CCTGTCCGTTATTGGCTTGT |