| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.244250 |
| Chromosome: | chromosome 12 |
| Location: | 6515989 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g538700 | CPLD62 | Conserved in the Plant Lineage and Diatoms; (1 of 2) PF07766 - LETM1-like protein (LETM1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTTGCGGCAGCCGACTCTTGTACACGTG |
| Internal bar code: | GCGAAACCCAGATCGCGTGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 619 |
| LEAP-Seq percent confirming: | 99.2999 |
| LEAP-Seq n confirming: | 1844 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCAGCGGGTAGACATCAT |
| Suggested primer 2: | GCTTGCAGAAGCTCTGTGTG |