| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.244256 |
| Chromosome: | chromosome 6 |
| Location: | 4933186 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279500 | CPL6 | Conserved in the Plant Lineage; (1 of 1) PTHR15852:SF8 - CHAPERONE PROTEIN DNAJ-LIKE PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATCCTTGCTCATCATGGCGTACCACCT |
| Internal bar code: | GATCAGCGGTGTATAGAACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 543 |
| LEAP-Seq percent confirming: | 98.3193 |
| LEAP-Seq n confirming: | 117 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACCGTACAAGCTACACGA |
| Suggested primer 2: | CAAGCGCGCAGTATATCAAA |