Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.244303 |
Chromosome: | chromosome 9 |
Location: | 2718774 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389550 | DNJ13 | (1 of 1) K09529 - DnaJ homolog subfamily C member 9 (DNAJC9); DnaJ-like protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCAAGTGTCGATCCTGGCATACCCTAAC |
Internal bar code: | GGCGCTGCCTCTCCGCCGATCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 677 |
LEAP-Seq percent confirming: | 98.0907 |
LEAP-Seq n confirming: | 822 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGACGAGCAGTGCCTCATA |
Suggested primer 2: | GACCTTCCTCATTGCACCTC |