| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.244332 |
| Chromosome: | chromosome 2 |
| Location: | 6544725 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g116900 | SETB,HDP1 | Homolog of small hydrophilic plant seed proteins; (1 of 1) PTHR34671:SF1 - EM-LIKE PROTEIN GEA6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGGTGGGACGCTGGTCGGAGACGAGAC |
| Internal bar code: | TGATAGCTGATACTTCTCGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 660 |
| LEAP-Seq percent confirming: | 98.4176 |
| LEAP-Seq n confirming: | 1928 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAGAAATAGCTCTCGTGG |
| Suggested primer 2: | TAGGAGATGGGACACAAGGG |