| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.244366 |
| Chromosome: | chromosome 12 |
| Location: | 5643124 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532300 | APG10,ATG10 | Autophagy-related protein; (1 of 228) IPR029063 - S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCACAGCCCTCGTAACCCCCCTCACAC |
| Internal bar code: | AGTCTATAACGTATTCACCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 943 |
| LEAP-Seq percent confirming: | 99.5525 |
| LEAP-Seq n confirming: | 6896 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGACAGTGTGTATCGGCAA |
| Suggested primer 2: | CCTTTCCTCAGCCCATATCA |