| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.244404 |
| Chromosome: | chromosome 13 |
| Location: | 1627704 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g573550 | ANK26 | Predicted protein with ankyrin repeats; (1 of 7) PF12796//PF13637 - Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCACTACCTTCCCGTCCCTCTCATGTG |
| Internal bar code: | GGTTCTCCATGCTCGGTCACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 542 |
| LEAP-Seq percent confirming: | 98.8439 |
| LEAP-Seq n confirming: | 171 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTTTCTTTGGGCCTGG |
| Suggested primer 2: | TCCGTCAACACAGTGGACAT |