| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.244434 |
| Chromosome: | chromosome 7 |
| Location: | 2473269 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g329250 | Putative metallochaperone; (1 of 1) PF02492//PF07683//PF13414 - CobW/HypB/UreG, nucleotide-binding domain (cobW) // Cobalamin synthesis protein cobW C-terminal domain (CobW_C) // TPR repeat (TPR_11) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGAACACGCCCTTCGACCTCAGCAGTGCC |
| Internal bar code: | CAGCAAAATCACCCGGTCACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 485 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 223 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACCATGAAGCAATTTGGA |
| Suggested primer 2: | GCACACAGCCAGTCAATCTG |