Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.244466 |
Chromosome: | chromosome 10 |
Location: | 1368246 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g427850 | (1 of 1) IPR000014//IPR000104//IPR013767 - PAS domain // Antifreeze protein, type I // PAS fold | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTATTCACCGTCGTTTTCAAACCCAGCGA |
Internal bar code: | AAATTTGTAATGATTAGAATCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 608 |
LEAP-Seq percent confirming: | 91.8103 |
LEAP-Seq n confirming: | 213 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATAGAGGTCAGCAGGCAGGA |
Suggested primer 2: | GCAGTTTACCAAGCTCAGGC |