Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.244598 |
Chromosome: | chromosome 10 |
Location: | 764113 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g422900 | (1 of 10) PTHR23257:SF520 - IP11267P | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCACGGCCACAGAAGCGCCCTGCCACACA |
Internal bar code: | CGCTTCTATCCCAAGCAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 428 |
LEAP-Seq percent confirming: | 96.6292 |
LEAP-Seq n confirming: | 86 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTTGCATACAGGGCAGTG |
Suggested primer 2: | CTGCACATGAATGGTTGAGG |