Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.244667 |
Chromosome: | chromosome 17 |
Location: | 4444195 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g732100 | SSA4 | cilia-sensing, structure and/or assembly; (1 of 1) PTHR21439//PTHR21439:SF0 - OXIDORED-NITRO DOMAIN-CONTAINING PROTEIN // PROTEIN OSCP1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTACCCTATCCCCGACACCAGCGCACAC |
Internal bar code: | GGCCTGGCGCCGGTTTCTGTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 606 |
LEAP-Seq percent confirming: | 99.0826 |
LEAP-Seq n confirming: | 864 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAAAACGGGACTGAGAACA |
Suggested primer 2: | ACTACCTACCGCCACAATGC |