| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.244679 |
| Chromosome: | chromosome 1 |
| Location: | 5640929 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040150 | (1 of 5) K08867 - WNK lysine deficient protein kinase [EC:2.7.11.1] (WNK, PRKWNK) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCTCGGCGCTGACCAGCTTCTCCACGC |
| Internal bar code: | GGTGGCCATCAAGCAGGGGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 822 |
| LEAP-Seq percent confirming: | 98.6677 |
| LEAP-Seq n confirming: | 4888 |
| LEAP-Seq n nonconfirming: | 66 |
| LEAP-Seq n unique pos: | 91 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTATCATATCCGGCGTGAC |
| Suggested primer 2: | AGATCGGTGATCTGGGTCTG |