| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.244695 |
| Chromosome: | chromosome 16 |
| Location: | 7307461 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684043 | ALDH24,ALDH24A1 | (1 of 1) 1.2.1.47 - 4-trimethylammoniobutyraldehyde dehydrogenase; Aldehyde dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTTGAGGTGATTGGCGGTCCAGTCAACA |
| Internal bar code: | CTTACGGGCGGGCGTTCCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 546 |
| LEAP-Seq percent confirming: | 99.5258 |
| LEAP-Seq n confirming: | 1679 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAGGCGCATATGGTAAGG |
| Suggested primer 2: | GGACAAGGTGGACACGTCTT |