| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.244703 |
| Chromosome: | chromosome 9 |
| Location: | 6230832 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g406200 | PRORS1,TSO1 | organellar class II (G, H%252C P and S) tRNA synthetase; (1 of 1) PTHR11451//PTHR11451:SF6 - TRNA SYNTHETASE-RELATED // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCAAACCCGCATGAGCACCGCACCGCAC |
| Internal bar code: | TCTTTGCCGGCGTCCGGGGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 585 |
| LEAP-Seq percent confirming: | 78.3505 |
| LEAP-Seq n confirming: | 380 |
| LEAP-Seq n nonconfirming: | 105 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTAGGTGGGACATGCTAA |
| Suggested primer 2: | ACAATGTCGTAAACACCGCA |