| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.244704 |
| Chromosome: | chromosome 16 |
| Location: | 4927339 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685550 | ASL4,Cys1A,OASTL4 | O-acetylserine (Thiol)-lyase/cysteine synthase 4; (1 of 3) 2.5.1.47 - Cysteine synthase / OAS sulfhydrylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTATGGCTGGCTGCAAGCAAACACGCGGT |
| Internal bar code: | AGCCACGTGACGGGGAGCACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 614 |
| LEAP-Seq percent confirming: | 98.4194 |
| LEAP-Seq n confirming: | 3051 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
| Suggested primer 2: | TCTGACTGGTGCAACTGAGG |