| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.244732 |
| Chromosome: | chromosome 14 |
| Location: | 4006477 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g633350 | (1 of 781) IPR000104 - Antifreeze protein, type I | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACACATGCCCACGCCCACACGCCCACAC |
| Internal bar code: | GTTGACCTGATGTCTTGGACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 152 |
| LEAP-Seq percent confirming: | 73.251 |
| LEAP-Seq n confirming: | 178 |
| LEAP-Seq n nonconfirming: | 65 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCTTTGCACACCACTTAT |
| Suggested primer 2: | GACTTGAGGAGGGAAGAGGG |