| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.244771 |
| Chromosome: | chromosome 11 |
| Location: | 2946015 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g478128 | GCN20 | Soluble ABC-F domain-containing protein related to GCN20; (1 of 1) K06158 - ATP-binding cassette, subfamily F, member 3 (ABCF3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTTCACGCTCCCCATACCCACACACACC |
| Internal bar code: | CGTTGCTATTAGAAAAACAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 366 |
| LEAP-Seq percent confirming: | 46.8531 |
| LEAP-Seq n confirming: | 804 |
| LEAP-Seq n nonconfirming: | 912 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGAAGACAGGGGAGGAG |
| Suggested primer 2: | TCTTCCGTGCCTAGCTCACT |