| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.244832 |
| Chromosome: | chromosome 13 |
| Location: | 1101685 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g569250 | CGLD9 | Conserved in the Green Lineage and Diatoms; (1 of 1) PF11255 - Protein of unknown function (DUF3054) (DUF3054) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGGTTGCTACCGCCTATCGGCATCAGG |
| Internal bar code: | GTTCCAGTCGATCGGGCCTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 547 |
| LEAP-Seq percent confirming: | 99.1803 |
| LEAP-Seq n confirming: | 2057 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTACGCAAGGACAATCG |
| Suggested primer 2: | GTGGAGGGGTTGAGACTTGA |