| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.244902 |
| Chromosome: | chromosome 2 |
| Location: | 1928331 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g087850 | PTK19 | Protein tyrosine kinase; (1 of 2) 2.7.10.2//2.7.11.25 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Mitogen-activated protein kinase kinase kinase / MLTK | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTGCCCAGCACGTGGCAGAGGAGGGC |
| Internal bar code: | GGAGGCATAGTTGCCCCGGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 194 |
| LEAP-Seq percent confirming: | 7.14286 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACACACACACACGTCGTA |
| Suggested primer 2: | CCCACAACAAACTCACGATG |