| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.244902 |
| Chromosome: | chromosome 7 |
| Location: | 936069 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319100 | TEF18 | Glutathione S-transferase-related protein; (1 of 1) 5.3.99.3 - Prostaglandin-E synthase / Prostaglandin-H(2) E-isomerase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCATTGCTTTAATTGTCTGTCGAACGG |
| Internal bar code: | TGGTGGGGCTCGGTGAAAAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 246 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCATTGAACAGCTCTCAT |
| Suggested primer 2: | GTACGTCCGTACCAGGCACT |