Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.244942 |
Chromosome: | chromosome 16 |
Location: | 1134633 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g650100 | PETN | Subunit of the chloroplast cytochrome b6f complex | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGCCTAACTCCAGCTGGGCTCATAGGGC |
Internal bar code: | TATGTACTTGTCTCGCAGCTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 713 |
LEAP-Seq percent confirming: | 99.2747 |
LEAP-Seq n confirming: | 8212 |
LEAP-Seq n nonconfirming: | 60 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCATACAAGGGGTGATGC |
Suggested primer 2: | TCAAACAGCAAGCACTGACC |