| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.244968 |
| Chromosome: | chromosome 9 |
| Location: | 3099424 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g386800 | (1 of 781) IPR000104 - Antifreeze protein, type I | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTACATGGACGGCTAACCCCCCCCACCC |
| Internal bar code: | CGGGGAGAGGGTCTATTTATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 91 |
| LEAP-Seq percent confirming: | 99.527 |
| LEAP-Seq n confirming: | 1473 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTACATTCAACCCCACTCC |
| Suggested primer 2: | GCTACAGCCGTCCAGAACTC |