| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.245048 |
| Chromosome: | chromosome 5 |
| Location: | 2922943 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238150 | (1 of 1) PF07646 - Kelch motif (Kelch_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCAAACGCATGCGCCCAGTGCTGACCCC |
| Internal bar code: | GGAAACGTATGAAAATTCTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 614 |
| LEAP-Seq percent confirming: | 88.5532 |
| LEAP-Seq n confirming: | 3605 |
| LEAP-Seq n nonconfirming: | 466 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTACTGCTACTGCCGCTA |
| Suggested primer 2: | CATTGGACTGTGTGTCAGGG |