Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.245130 |
Chromosome: | chromosome 2 |
Location: | 6266414 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g114350 | (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCGGTGCCCTGCTGGTTGCGCAATGTG |
Internal bar code: | TATATTCATAAGCTGAAGGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 48 |
LEAP-Seq percent confirming: | 91.8919 |
LEAP-Seq n confirming: | 68 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGCGTAGATGACCCTGACC |
Suggested primer 2: | TCGAGGACAAAACGCATACA |