| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.245130 |
| Chromosome: | chromosome 2 |
| Location: | 6266414 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g114350 | (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCGGTGCCCTGCTGGTTGCGCAATGTG |
| Internal bar code: | TATATTCATAAGCTGAAGGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 48 |
| LEAP-Seq percent confirming: | 91.8919 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCGTAGATGACCCTGACC |
| Suggested primer 2: | TCGAGGACAAAACGCATACA |