Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.245146 |
Chromosome: | chromosome 16 |
Location: | 1112878 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g649800 | PPR3,CYCR6 | (1 of 1) PF02984//PF13041 - Cyclin, C-terminal domain (Cyclin_C) // PPR repeat family (PPR_2); PentatricoPeptide Repeat protein 3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTTGTTGTGCCCTGCGCGCCACCCCGGG |
Internal bar code: | TGGTCCTTCAGGCAGTGTTGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 330 |
LEAP-Seq percent confirming: | 99.7042 |
LEAP-Seq n confirming: | 3034 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCGCTGTGATCAGGCTATT |
Suggested primer 2: | CCACTTACTGCCACCACCTT |