| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.245179 |
| Chromosome: | chromosome 6 |
| Location: | 4906012 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279250 | PYM1 | (1 of 1) K14294 - partner of Y14 and mago (WIBG, PYM); Partner of Y14/RBM8A-MAGOH | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATGAGCTAAGGTTGCTAGCGGACAGCTT |
| Internal bar code: | GACTGGGACGTTAGCCCGACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 947 |
| LEAP-Seq percent confirming: | 99.518 |
| LEAP-Seq n confirming: | 33033 |
| LEAP-Seq n nonconfirming: | 160 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGAGGCATATCCTGTTTCC |
| Suggested primer 2: | ATGAAAGCAACACCTCACCC |