Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.245252 |
Chromosome: | chromosome 16 |
Location: | 2550882 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g661350 | RBCMT1,RMT1 | (1 of 1) K00592 - [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase (E2.1.1.127); ribulose-1%252C5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTAGAGCAACCGCCACAACCACCACCACC |
Internal bar code: | TTATCGCACCCGCCGTCCCACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 367 |
LEAP-Seq percent confirming: | 99.2092 |
LEAP-Seq n confirming: | 3262 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCTGGAGTCCATCTTCCG |
Suggested primer 2: | ATCGCGGGACAAACTTACAC |