| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.245283 |
| Chromosome: | chromosome 9 |
| Location: | 2632642 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g390200 | IPY2 | Inorganic pyrophosphatase; (1 of 4) K01507 - inorganic pyrophosphatase (ppa) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAAGGGGCGACACTGGGAGACGAGAGA |
| Internal bar code: | AGAATCAACGGGGGCTGAGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 584 |
| LEAP-Seq percent confirming: | 15.2064 |
| LEAP-Seq n confirming: | 210 |
| LEAP-Seq n nonconfirming: | 1171 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | AGGCAAGACTAGCGTTTGGA |