| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.245285 |
| Chromosome: | chromosome 3 |
| Location: | 3769492 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g169950 | (1 of 1) PF02373//PF02375 - JmjC domain, hydroxylase (JmjC) // jmjN domain (JmjN) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCTCGCTCACCCACTGCACCTCCTTC |
| Internal bar code: | CCGTCGTGAGAGTGGGTCCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 495 |
| LEAP-Seq percent confirming: | 99.4151 |
| LEAP-Seq n confirming: | 6629 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGTAACAGCCGTTGAACC |
| Suggested primer 2: | GCTGCCATGCTGCTACATAA |