| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.245390 |
| Chromosome: | chromosome 6 |
| Location: | 296804 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g251050 | (1 of 1) 2.7.11.1//2.7.11.27//2.7.11.31 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // [Acetyl-CoA carboxylase] kinase / I-peptide kinase // [Hydroxymethylglutaryl-CoA reductase (NADPH)] kinase / Reductase kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCCGCCCACGATGCGCCGCAGCCGCTGT |
| Internal bar code: | GCATCGGTGTTTCAGCCTTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 62 |
| LEAP-Seq percent confirming: | 7.79221 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 142 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTATCCCTCCGCCTCTAACC |
| Suggested primer 2: | TCATCTCCTCCTGGATTTGG |