Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.245396 |
Chromosome: | chromosome 10 |
Location: | 3497393 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g445050 | SLT3 | (1 of 1) IPR001898//IPR004680//IPR006037 - Sodium/sulphate symporter // Citrate transporter-like domain // Regulator of K+ conductance, C-terminal; Sodium/sulfate co-transporter 3 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCACCAACCTGGTCATCGTGGGCATGCA |
Internal bar code: | GGGATATGTGACGCAGGAGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 553 |
LEAP-Seq percent confirming: | 97.0149 |
LEAP-Seq n confirming: | 130 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGACCAGAGCGGAAGACG |
Suggested primer 2: | GTACAGGATGTCGTTGGCCT |