Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.245425 |
Chromosome: | chromosome 2 |
Location: | 6582786 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g117150 | (1 of 1) PTHR23077:SF10 - PACHYTENE CHECKPOINT PROTEIN 2 HOMOLOG | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGAACAGCCGACTCACCTGGTGATGAGA |
Internal bar code: | GGCAGGTTTGGTAGGTTGCTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 462 |
LEAP-Seq percent confirming: | 99.64 |
LEAP-Seq n confirming: | 1384 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCATACCATGTATGAGCCC |
Suggested primer 2: | GGGTAAGTCCCAAGTCACGA |