| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.245458 |
| Chromosome: | chromosome 1 |
| Location: | 3553697 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g022800 | FAL1 | Similar to Flagellar Associated Protein FAP159 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTTTGCCGACTATCCTGCTACAATATGA |
| Internal bar code: | AAATGCACACGGGCTTGTTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 418 |
| LEAP-Seq percent confirming: | 99.0244 |
| LEAP-Seq n confirming: | 203 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCTGCTCACGAGTGTGAT |
| Suggested primer 2: | TGAAATCATTCCCAGCTTCC |