| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.245558 |
| Chromosome: | chromosome 7 |
| Location: | 4669677 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g344600 | PGD1,PGDH1 | (1 of 1) PTHR10996:SF159 - D-3-PHOSPHOGLYCERATE DEHYDROGENASE; D-3-phosphoglycerate dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCCCCCCGCCGCTCGGCAGGGCGTGCT |
| Internal bar code: | AGGGACCAGGTGATAGGGGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 211 |
| LEAP-Seq percent confirming: | 96.9697 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
| Suggested primer 2: | CCCTGGTTGTGGTTCAGTCT |