| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.245592 |
| Chromosome: | chromosome 3 |
| Location: | 9212598 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g213425 | COX23 | (1 of 9) IPR009069 - Cysteine alpha-hairpin motif superfamily; Cytochrome c oxidase assembly protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTGTCACTGCACTGCTGGCACCCACCG |
| Internal bar code: | ACCGCACTTGCGCGACAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 549 |
| LEAP-Seq percent confirming: | 99.6231 |
| LEAP-Seq n confirming: | 793 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCACTCTTCCAGCTTTGG |
| Suggested primer 2: | GAAGTTTGTTTCCTGCGCTC |